BACKGROUNDCoronary heart disease (CHD) is the leading cause of mortality and morbidity in many countries, a number of genetic risk factors for the development of coronary heart disease has been identified in the past. Haptoglobin(Hp), one of theacute phase proteins, is an acid glycoprotein, Haptoglobin acts as an antioxidant by scavenging free hemoglobin, Haptoglobin has also been identified as an protein that can inhibit synthesis of prostaglandin, promote vascularization and adjust immunity.A major function of haptoglobin is to bind hemoglobin (Hb) to form a stable Hp-Hb complex and thereby prevent Hb-induced oxidative tissue damage and iron loss and renal damage. Clearance of the Hp-Hb complex can be mediated by the monocyte/macrophage scavenger receptor CD163.The Hp gene is located on the long arm of chromosome 16(16q22.1).An allelic polymorphism gives rise to two distinct alleles, Hp1 and Hp2, defining three major phenotypes, denoted Hpl-1, Hp2-1 and Hp2-2. The Hp2 allele has an internal duplication of 1.7 kb but not in Hp1 allele that includes 2 of the alpha-chain exons. Most likely, formation of the Hp2 allele is the result of a breakage and reunion event at nonhomologous positions within the fourth and second introns of two Hp1 genes.For the distinction of the formation in Hp gene,we can use genotyping method based on PCR.Asleh et al assessed the scavenging function of Hp using radiolabeled Hp in cell lines stably transfected with CD163 and in macrophages expressing endogenous CD163. They found that the rate of clearance of Hp1-1-Hb by CD163 was markedly greater than that of Hp2-2-Hb. Moreover,Hp acts as an antioxidant by scavenging free hemoglobin, Hp has also been identified as an protein that can inhibit synthesis of prostaglandin, promote vascularization and adjust immunity, which associated with the development of coronary heart disease.Because of the Hp polymorphism, and the distinction of physiological function in genotypes, the research on the relationship between this polymorphism and coronary heart disease may be worthy. SUBJECT AND METHODS 1.   SubjectsCHD group: 189 coronary heart disease patients(149 men and 40 women,mean aged 63.14 ± 10.38 years) were consecutively collected from the hospitalized in the department of cardiology, the second affiliated hospital of medical college, Zhejiang University from March, 2005 to December, 2005. All patients were confirmed by coronary angiography.Control group: 242 control group subjects(175 men and 67women, mean aged 61.56 ± 10.44 years). All subjects were consecutively collected from hospitalized in the department of cardiology in the second affiliated hospital of medical college, Zhejiang University in the same time , All patients were confirmed normal by coronary angiography.All subjects were Chinese Han nationality, there was no blood relationship between individuals in the study population. 2.  Diagnosis of CHDThe diagnosis of coronary heart disease was determined by angiograhy. Angiograms were assessed by two cardiologists who were unaware that the patients were to be included in the study. Each angiogram was classified as revealing either coronary lesion with more than 50% stenosis or less . Significant coronary artery disease was defined as [is greater than or equal to] 50% luminal diameter stenosis with one, two, or three major epicardial coronary arteries. Risk for coronary heart diseaseAll patients completed a questionnaire that included demographic data: age, sex, hyperlipidemia, hypertension, diabetes mellitus and smoking, et al.1). Hyperlipidemia was defined as serum total cholesterol (TC) 200mg/dl or more;   low-density   lipoprotein   cholesterol   (LDL-C)   120mg/dl   or   more; triglyceride (TG) 150mg/dl or more; high-density lipoprotein cholesterol (HDL-C) 40mg/dl or less.2). Hypertension was defined as 140/90mmHg or more. Both previous medical records of raised blood pressure and present values were collected.3).   Diabetes mellitus (DM) was recorded in accordance with 1997 criteria by the Expert Committee of American Diabetes Association (ADA).4). Smokes consists of current smokes and patients who had ceased smoking.Evaluation of the number of cigarettes consumed per day was thought to be unreliable.3.   Laboratory methods for Hp gene polymorphism1).DNA was extracted from the peripheral blood leukocytes by standard phenol and chloroform method.2).Hp genotype was determined by PCR, Oligonucleotide primer 1(5_-GCTGTCACTGCTGCGTAAAG          -3_)          and          primer2          (5_-GGTCAGTCTTTGGTTGGGTAG -3_) were used for amplification of a Hp 1 allele-specific sequence and primer3(5_- CCTGCCTCGTATTAACTGCACAT -3_) and primer4(5_- CCGAGTGCTCCACATAGCCATGT -3_) were used for amplification of Hp 2 allele-specific sequence. The 20μl reactions contained 0.4μl of Takara LATaq polymerase, 1μl of DNA, 0.5μl of dATP,dCTP, dGTP, and dTTP; 2μl of PCR buffer without Mg~(2 ),0.5μl of each primer and 2μl of MgCl_2-After initial denaturation at 95 °C for 3 min, the two-step thermocycling procedure consisted of denaturation at 95 °C for 1 min and annealing and extension at 69 °C for 2 min (in the presence of primer1 and 2) or 1 min (in the presence of primer3 and primer 4 ), repeated for 35 cycles, and followed by a final extension at 72 °C for 7 min. the PCR products were separated in 0.7% (Hp 1 allele-specific sequence)or 1% (Hp 2 allele-specific sequence) agarose gels.4.   Statistical analysisStatistic analyses were performed with the SPSS for windows 11.5 statistic program package. All continuous variables were expressed as mean±standard deviation. The gene counting method was used to estimate the allele and genotype frequencies in patients group and control group.The Hardy-Weinberg equilibrium for the frequencies of genotypes was tested by z~2 analysis.Clinical characteristics between different groups were tested with one-way ANOVA or nonparametric test. Comparison between groups was performed by t test or one-way ANOVA. Values were considered statistically significant atP0.05).5.   The genotypes distribution of Hp was no different between CHD patients with and without family history of cardiovascular disease(P>0.05).Conclusions1. There is a polymorphism of Hp in Zhejiang Han population, the distribution of Hp polymorphism were different between Chinese Han population and other populations of diverse ethnic origin.2. Hp2-2 were involed in the occurrence and the development of CHD, especially ACS.3.  There is no relationship between Hp polymorphism and classic risk factors of CHD.4.  There is no relationship between Hp polymorphism and famil y history of cardiovascular disease.

Comments(0) | Trackbacks(0) | Reads(166)